HAND, FOOT AND MOUNT DISEASE

BAB I

PENDAHULUAN

1.1       Latar Belakang
Sejak beberapa tahun lalu muncul beberapa penyakit yang  menimbulkan jumlah kematian yang cukup besar. Salah satu penyakit yang menyebabkan kegemparan diseluruh dunia adalah penyakit yang berasal dari virus influenza termutasi. Influenza virus mempunyai RNA (Ribo Nucleic Acid) sebagai material genetiknya. Virus ini cepat sekali bermutasi karena tidak memiliki enzim yang bisa memperbaiki jika seandainya ada kesalahan dalam pembacaan material genetik dalam tubuhnya. Kemampuan influenza virus untuk selalu bermutasi inilah yang menyebabkan vaksin influenza tidak bisa hanya diterima 1 kali seumur hidup tapi harus diberikan setiap tahun, karena setiap tahun vaksin harus dibuat dengan menyesuaikan material genetik dari virus yang sedang mewabah tahun itu.
Influenza virus dibagi menjadi 3 tipe, A, B dan C. Influenza virus tipe A dan B-lah yang biasanya bertanggung jawab menyebabkan wabah flu setiap tahun (seasonal influenza), sedangkan tipe C biasanya hanya menyebabkan gejala flu ringan dan jarang menyebabkan wabah. Influenza virus tipe A merupakan penyebab utama pandemik yang belakangan ini merebak.
Saat ini penyakit flu yang sedang adalah flu Singapura. Sudah sewajarnya jika kita berusaha mencari informasi lebih lanjut tentang penyakit tersebut.
1.2 Tujuan
- Untuk mengetahui berbagai permasalahan atau pentakit yang menyerang tangan,kaki, dan mulut.
-  Untuk melakukan pencegahan dan pengobatan dini apa bila saat melakukan skrining terdapat penyakit kaki tangan dan mulut pada



BAB II

PEMBAHASAN


2.1       Definisi
Flu Singapore sebenarnya adalah penyakit yang di dunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau dalam bahasa Indonesia disebut Penyakit Tangan, Kaki, dan Mulut (PTKM). Penyakit ini sesungguhnya sudah lama ada di dunia. Berdasarkan laporan yang ada, penyakit ini sudah ada di tahun 1957 di Toronto, Kanada. Sejak itu terdapat banyak kejadian di seluruh dunia. Di Indonesia sendiri sebenarnya penyakit ini bukan penyakit baru. Istilah Flu Singapore muncul karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura. Karena gejalanya mirip flu, dan saat itu terjadi di Singapura (dan kemudian juga terjadi di Indonesia), banyak media cetak yang membuat istilah flu Singapore, walaupun ini bukan erminology yang baku.
Hand-Foot-Mouth disease adalah penyakit anak-anak yang umum terjadi. Gejalanya berupa luka pada mulut, demam, dan rash. Biasanya disebabkan oleh coxsackievirus A16. Akan tetapi tidak semua anak-anak yang terinfeksi virus ini  menunjukkan ketiga gejala Hand-Foot-Mouth disease ini. HFMD sering keliru dengan penyakit Foot-and-Mouth disease (Hoof-and-Mouth disease) yang terjadi pada lembu, domba, dan babi; padahal keduanya merupakan dua macam penyakit yang berbeda dan tidak berhubungan, keduanya disebabkan oleh virus yang berbeda. Manusia tidak dapat tertular penyakit yang diderita oleh binatang dan demikian juga sebaliknya.

            

         
Gambar 1. Manifestasi klinik flu Singapura

2.2       Etiologi
HFMD adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus (non Polio). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus.
Di dalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus. Penyebab PTKM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.
art-e0701.22.fig1.jpg
      Gambar 2. Coxsackie A virus

              Gambar 3. Coxsackie A virus dilihat dengan mikroskop elektron

2.3       Epidemologi
Penyakit ini sangat menular dan sering terjadi dalam musim panas. PTKM adalah penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya lebih kebal terhadap enterovirus, walau bisa juga terkena.
Orang yang belum pernah terinfeksi oleh virus yang menyebabkan HFMD beresiko untuk terinfeksi, tapi tidak semua orang yang terinfeksi virus ini menderita HFMD.
HFMD paling banyak terjadi pada anak-anak berusia di bawah 10 tahun, tapi dapat pula terjadi pada orang dewasa. Anak-anak lebih beeresiko untuk terkena penyakit ini karena system imun dalam tubuh mereka masih lemah bila dibandingkan dengan orang dewasa.
Bila telah terinfeksi maka pasien akan mendapatkan immunitas terhadap virus yang dapat menyebabkan HFMD ini. Tapi terdapat pula beberapa kasus dimana HFMD dapat kembali muncul karena infeksi oleh virus golongan enterovirus lainnya.
Kasus HFMD terjadi di seluruh dunia. Pada daerah yang beriklim hangat atau sejuk, kasus lebih sering terjadi pada musim panas dan awal musim gugur. Sejak tahun 1997, kasus-kasus HFMD yang disebabkan oleh enterovirus 71 telah dilaporkan terjadi di Asia dan Australia.
HFMD yang disebabkan oleh infeksi coxsackievirus A16 merupakan penyakit yang ringan. Umumnya pasien dapat sembuh setelah 7-10 hari tanpa penanganan medis. HFMD yang disebabkan oleh enterovirus 71 menunjukkan insiden penyakit neurologis (sistem saraf) yang lebih tinggi. Kasus encephalitis yang fatal dapat terjadi pada penyakit yang disebabkan oleh infeksi enterovirus 71.
Implantasi awal virus pada mukosa buccal dan ileum akan diikuti dengan penyebaran ke kelenjar getah bening dalam 24 jam. Viremia cepat terjadi, meluas ke mukosa mulut dari kulit. Hari ke 7 terjadi peningkatan neutralizing antibody kemudian terjadi eliminasi Virus.

Kasus HFMD
  • Tahun 1997
                        Tiga puluh empat anak meninggal di Sarawak, Malaysia.
  • Tahun 1998
Kasus HFMD dilaporkan terjadi di Taiwan. Sekitar 405 pasien mengalami komplikasi akut, dan 78 anak meninggal. Jumlah total kasus epidemic yang terjadi telah mencapai 1,5 juta.

·         Tahun 2006

7 orang meninggal karena penyakit HFMD di Kutching, Sarawak (sumber New Straits Times, 14 Maret)

·         Tahun 2008

Dilaporkan 25.000 kasus infeksi HFMD dengan jumlah korban meninggal 42 orang terjadi di Fuyang, Anhui, China pada awal Maret. Hal yang serupa juga dilaporkan terjadi di Singapore (lebih dari 2.600 kasus pada 20 April 2008), Vietnam (2.300 kasus dengan 11 kematian), Mongolia (1.600 kasus), dan Brunei (1053 kasus selama bulan Juni-Agustus 2008).

·         Tahun 2009

Kasus lainnya dilaporkan terjadi pada bulan April 2009, di kota Heze dan provinsi Shandong, bagian timur China, dengan jumlah penderita yang meninggal mencapai 15 orang. Hingga saat ini Dinas Kesehatan Provinsi Shandong melaporkan 5.770 kasus terjadi di Heze, Dari 5.770 kasus tersebut 4.549 dilaporkan sembuh sedangkan 341 kasus lainnya hingga saat ini belum dapat diatasi.

Hingga 7 April 2009, lebih dari 115.000 kasus telah dilaporkan dan 50 orang meninggal karena infeksi ini. Tetapi kebanyakan kasus hanya terjadi di daerah pedesaan, di mana populasinya jarang dan hamper 80% total kasus terjadi di 10 provinsi dan daerah otonomi mencakup Henan, Shandong, Jiangsu, Guangxi, dan Zhejiang.

Di Indonesia terdapat laporan kasus infeksi ini di daerah Jakarta dan sekitarnya. Kasus yang pertama dilaporkan terjadi pada 8 orang anak berusia satu sampai empat tahun. Dinas kesehatan Jakarta pada bulan April mengeluarkan peringatan akan bahaya HFMD dan larangan untuk bepergian ke Singapura.


2.4       Cara Penularan
Penularannya melalui jalur fekal-oral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (carrier) seperti lalat dan kecoa. Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 - 5 hari.
Infeksi ini paling menular pada satu minggu pertama. Virus yang menyebabkan HFMD masih dapat tinggal di dalam tubuh selama berminggu-minggu setelah symptom menghilang. Berarti penularan dari orang ke orang terjadi setelah pasien penyakit ini beranjak sembuh. HFMD tidak ditransmisikan dari binatang ke manusia.
2.5       Manifestasi Klinik
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu makan, pilek, gejala seperti flu, pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan (lidah, gusi, pipi sebelah dalam) terasa nyeri sehingga sukar untuk menelan. Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) pada bokong.
 

                       
                                                                                                                                   

 








Gambar 4. Manifestasi klinik flu Singapura

Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di rumah sakit. Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah sakit.
Gejala Prodromal (12-36 jam) :
  • Demam tidak tinggi±38,3 derajat C selama 2-3 hari
  • Anoreksia
  • Malaise (feeling sick)
  • Nyeri perut
  • Sakit pada mulut dan tenggorokan
  • Batuk
  • Lesi pada tangan dan kaki; 5-7 hari
  • Lesi mukosa dan kulit sembuh spontan dalam 5-7 hari
  • Kadang-kadang : demam tinggi, sangat lemah, diare, atralgia, miokarditis dan pneumonia, meaningoencephalitis.

Adapun gambaran klinik Lesi di mulut :
  • Macula, vesikel 2-3 mm dasar eritem
  • Vesikel jarang terlihat, segera menjadi ulkus
  • Ulkus terasa nyeri ditambah dengan rasa tidak nyaman ketika makan
  • Jumlah ulkus 5-10
  • Terlihat pada palatum, mukosa pipi, gusi, lidah, uvula, tonsil.

Adapun gambaran klinik lesi di kulit :
  • Lokasi khas yaitu tangan, kaki, bokong dan kadang-kadang di lengan.
  • Jumlah lesi di tangan > jumlah lesi di kaki
  • Jumlah lesi di dorsal dan sisi samping jari-jari>jumlah lesi di palmar
  • Makula eritem 2-10 mm kemudian berubah menjadi vesikel sentral oval berwarna abu-abu
  • Lesi asimtomatik, hilang 3-7 hari
  • 22% cervikal/submandibular limfadenopati.

Gejala yang cukup berat tersebut antara lain :
  • Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39oC.
  • Demam tidak turun-turun
  • Takikardia (denyut nadi menjadi cepat)
  • Takipnea, yaitu napas jadi cepat dan sesak
  • Anoreksia, muntah, atau diare berulang disertai dehidrasi.
  • Letargi, lemas, dan terus mengantuk
  • Nyeri pada leher, lengan, dan kaki.
  • Kejang-kejang, atau terjadi kelumpuhan pada saraf cranial
  • Keringat dingin
  • Fotofobia (tidak tahan melihat sinar)
  • Ketegangan pada daerah perut
  • Halusinasi atau gangguan kesadaran

            Komplikasi pada penyakit HFMD jarang terjadi, tetapi bila terdapat komplikasi harus segera ditangani. Komplikasi penyakit ini adalah :
·         Viral atau aseptik meningitis (radang selaput otak)
Viral meningitis dapat menyebabkan demam, sakit kepala, leher dan punggung. Kondisi ini biasanya ringan dan dapat sembuh tanpa penanganan.
·         Ensefalitis (radang otak)
Dapat berakibat fatal.
·         Myocarditis (Coxsackie Virus Carditis) atau pericarditis
·         Acute Flaccid Paralysis / Lumpuh Layuh Akut (Polio-like illness)
·         Hilangnya kuku jari tangan dan kaki
Hanya bersifat sementara dan dan dapat sembuh tanpa pengobatan.

Penyakit yang ternasuk ke dalam satu kelompok dengan penyakit ini adalah :
1. Vesicular stomatitis dengan exanthem (PTKM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10

2.6       Diagnostik Klinik
Biasanya diagnosis yang ditegakkan berdasarkan dari sejarah dan pemeriksaan fisik. Dapat dilakukan test laboratorium untuk coxsackievirus dan enterovirus lain, tetapi biasanya tidak diperlukan.
Penyakit ini sering keliru dengan penyakit kerongkongan yang disebabkan oleh bakteri Streptoccocus, yang juga biasanya ditandai dengan demam dan sakit kerongkongan (sore throat). Terkadang juga keliru dengan penyakit cacar air karena keduanya menghasilkan blister/vesicle (lepuh/tonjolan kecil pada epidermis yang mengandung cairan serosa) dan dengan penyakit exanthema pada anak-anak (demam yang disertai dengan erupsi) karena terjadi infeksi telinga yaitu merahnya gendang telinga.
Sampel (Spesimen) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak. Spesimen dibawa dengan Hank Virus Transport. Isolasi virus dengan cara biakan sel dengan suckling mouse inoculation. Setelah dilakukan Tissue Culture, kemudian dapat diidentifikasi strainnya dengan antisera tertentu (IPA, CT, PCR dll). Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium HFMD meliputi:
1. Deteksi Virus :
- Immuno histochemistry (in situ)
- Imunofluoresensi antibodi (indirect)
- Isolasi dan identifikasi virus.
Pada sel Vero; RD; L20B Uji netralisasi terhadap intersekting pools Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

2. Deteksi RNA
RT-PCR Primer : 5’ CTACTTTGGGTGTCCGTGTT 3’ 
5’ GGGAACTTCGATTACCATCC 3’  Partial DNA sekuensing (PCR Product)

3. Serodiagnosis
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero. Uji ELISA sedang dikembangkan. Sebenarnya secara klinis sudah cukup untuk mendiagnosis HFMD, hanya kita dapat mengetahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
Diagnosa banding :
o  Stomatitis aphtosa
o  Chickenpox
o  Eritema multiform
o  Herpes Simplex

2.7       Pengobatan
         Berikut ini merupakan cara – cara pengobatan penyakit HFMD:
 1. Istirahat yang cukup
 2. Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan keadaan klinis yang ada.
 3. Dapat diberikan:
- Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
- Extracorporeal membrane oxygenation.
 4. Pengobatan simptomatik:
- Antiseptik di daerah mulut
- Antipiretik
- Analgesik misal parasetamol
- Antibiotika jika infeksi kulit
- Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
- Pengobatan suportif lainnya 
n  Nyeri : Kumur air garam
n  Intake oral penderita : minuman dingin (semacam susu), menghindari juice sitrus karena “menyengat”
n  Campuran (jumlah sama) : mukolitik/ekspektoran dan antasida dikumur kemudian dibuang/diludahkan.
n  Gizi, dll.
Penyakit ini merupakan self limiting diseases, yaitu penyakit yang dapat sembuh dengan sendirinya, dalam 7-10 hari. Tidak ada pengobatan spesifik untuk infeksi ini, selain dari terapi untuk mengatai simptomnya. Pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.
Hal yang terpenting untuk menangani penyakit ini adalah meredakan sakit (pain relief) dan memperbanyak cairan tubuh. Berkumur dengan air garam (1/2 sendok the garam untuk 1 gelas air hangat), es loli dan cairan dingin dapat digunakan untuk meredakan rasa sakit pada kerongkongan yang terluka.
Terapi dengan antibiotik tidak efektif pada penyakit ini. Obat bebas terbatas (over-the-counter medicines), seperti Tylenol (acetaminophen) dapat digunakan untuk mengatasi demam. Aspirin dapat pula digunakan, akan tetapi sebaiknya tidak dipakai untuk anak di bawah usia 12 tahun.
Pastikan pasien tidak kekurangan cairan. Pemberian cairan tambahan diperlukan ketika terjadi demam.Jangan memberikan jus atau soda karena kandungan asamnya dapat menimbulkan rasa terbakar pada ulcer.

2.8       Pencegahan dan Pengendalian Penyakit
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan kekumuhan dan kepadatan lingkungan; kebersihan (Higienis dan Sanitasi) lingkungan maupun perorangan. Cara yang paling gampang dilakukan adalah misalnya membiasakan selalu cuci tangan, khususnya sehabis berdekatan dengan penderita, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi. Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang.
Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan. Di Rumah sakit Universal Precaution harus dilaksanakan. Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi). Bila anak tidak dirawat, harus istirahat di rumah karena daya tahan tubuhnya menurun dan agar tidak menularkan ke anak lainnya.
Berbagai upaya telah dan sedang dilakukan pemerintah dalam hal ini, seperti meningkatkan survailans epidemiologi (perlu definisi klinik). Memberikan penyuluhan tentang cara-cara penularan dan pencegahan HFMD untuk memotong rantai penularan. Menyiapkan sarana kesehatan tentang tatalaksana HFMD termasuk pelaksanaan. Memberikan penyuluhan tentang tanda-tanda dan gejala HFMD.
Jadi, dapat disimpulkan bahwa tidak terdapat pengobatan secara spesifik untuk penyakit ini. Adapun hal – hal yang dapat dilakukan antara lain:
o  Menghindari kontak dengan anak-anak yang terinfeksi
o  Tidak membawa anak yang sakit ke tempat yang padat pengunjung
o  Tidak menggunakan peralatan makan,pakaian,sepatu anak yang sakit.
o  Mencuci tangan sebelum dan sesudah makan, buang air besar dan kontak dengan penderita
o  Bintik yang melepuh/vesikel sebaiknya dibiarkan mengering alami, jangan dipecah karena mengandung virus.
o  Penderita tutup mulut dan hidung saat batuk/bersin
o  Bersihkan lantai atau barang-barang yang terkontaminasi kotoran anak dengan perklorin 0,5% karena virus berada dalam feses dan dapat hidup beberapa lama.

2.9 Upaya Pemerintah
ü  Meningkatkan survailans epidemiologi (perlu definisi klinik).
ü  Memberikan penyuluhan tentang cara-cara penularan dan pencegahan PTKM untuk memotong rantai penularan.
ü  Memberikan penyuluhan tentang tanda-tanda dan gejala PTKM
ü  Menjaga kebersihan perorangan.
ü  Bila anak tidak dirawat, harus istirahat di rumah karena :
- Daya tahan tubuh menurun.
- Tidak menularkan kebalita lainnya.
ü Menyiapkan sarana kesehatan tentang tatalaksana PTKM termasuk
Pelaksanaannya


BAB III
PENUTUP

3.1  KESIMPULAN

Flu Singapura (penyakit tangan, kaki dan mulut) disebabkan oleh virus RNA yaitu Coxsakie A Virus, Coxsakie B Virus, Echovirus dan Enterovirus. Gejalanya antara lain demam tidak tinggi, faringitis, tidak ada nafsu makan, pilek, ulkus di mulut, ruam atau timbul vesikel. Gejala yang cukup berat diantaranya hiperpireksia, demam yang tidak turun-turun, takikardi, takipneu, muntah, letargi, lemas, kejang-kejang, fotofobia, halusinasi.
Diagnosa laboratorium flu Singapura diantaranya deteksi virus, deteksi RNA dengan RT-PCR  Primer serta serodiagnosis. Pengobatannya bersifat simptomatis, yaitu hanya mengobati gejalanya saja karena penyakit ini bersifat self limiting disease.

3.2     SARAN
Usaha pencegahan demi menghindari tersebarnya virus penyebab flu Singapura maupun perlu dilakukan. Usaha pencegahan tersebut diantaranya adalah menciptakan kondisi lingkungan yang bersih (higienis dan sanitasi lingkungan maupun perorangan diperhatikan), menghindari kontak secara langsung dengan hewan yang diduga terinfeksi, serta menjaga daya tahan tubuh.
Apabila diduga terinfeksi, maka diperlukan penanganan medis segera agar virus tidak menyebar serta pasien harus segera memperoleh pengobatan yang tepat.






DAFTAR PUSTAKA

Comments

Popular posts from this blog

CONTOH SOAP ASUHAN KEBIDANAN PADA IBU BERSALIN

PROSEDUR KLINIK : PEMERIKSAAN URINE IBU HAMIL ( GLUKOSA URINE & PROTEIN URINE )

PERENCANAAN KESEHATAN (HEALTH PLANNING)